yagbol Posted February 23, 2010 Share Posted February 23, 2010 bosing kas, tama ang model na hanap ko. wait ko na lang kung may stock ka. asian fit ba ang kinukuha mo? Quote Link to comment
SirHardenuf Posted February 23, 2010 Share Posted February 23, 2010 Sir ako paorder ng: Treaty 2.0 Polished Brown/Cappuccino 22-091Drill Bit Matte Black 22-211and a Bracket 2.1 Quote Link to comment
vinrose67 Posted February 24, 2010 Share Posted February 24, 2010 http://2.bp.blogspot.com/_0H0gnjnDGWo/R1QGFokV7MI/AAAAAAAAGJM/uy8eod-IOIo/s1600-R/oakley_mcnish2.jpg Bro Kas ask ko lang kung anong model type ng oakley eto? see pic above. i think it's a gascan pero iba kasi ang frame nya, Meron ka bang ganyang model? Quote Link to comment
kasmutingrato Posted February 24, 2010 Author Share Posted February 24, 2010 sir Dwinski <<<<< copy sir ill get you that modelsir koopahl <<<<< sir alam mo naman mas mura ako sa mall wala pa po ako idea kung magkano to... ill get it sir sir alexzander<<<< re prices sir for livestrong pag dumating sir dun palang malalaman po, ill order it sir take it or leave it its okie lang po sir JaguarLima <<<<< thnx for the invites sir SirHardenuf <<<<< copy and noted sir, sir bracket ? hindi ako makakakuha nito Oakley original products lang sir kaya ko. as per Oakley claims- if you cannot find the model of Oakley "eye wears" in there site, then its not made by Oakley... Bracket is made in Japan, Oakley Foot Hill doesn't recognized that model.... correct me po if im wrong... sir vinrose67 <<<<<<< hanapin ko po to kung ano yun model nun.... TO ALL POST LANG PO NG ORDER TNX.... Quote Link to comment
burnik20 Posted February 25, 2010 Share Posted February 25, 2010 i've sent you pm sir, thanks! Quote Link to comment
kasmutingrato Posted February 26, 2010 Author Share Posted February 26, 2010 i've sent you pm sir, thanks! copy sir.... Quote Link to comment
ray004 Posted February 26, 2010 Share Posted February 26, 2010 bro kas how much Wiretap? http://www.oakley.com/pd/1252/2798 Quote Link to comment
mojoko Posted February 26, 2010 Share Posted February 26, 2010 gud am bro i have polarized romeo 2. meron k bang lens for romeo 2 kahit hindi na polarized gave me ur price. thanks Quote Link to comment
mmaunltd Posted February 28, 2010 Share Posted February 28, 2010 sir baka meron kang hijinx white? tnx Quote Link to comment
greg8tan Posted February 28, 2010 Share Posted February 28, 2010 Follow up on my order for Split Thread Chrome Prescription Glasses Thanks Quote Link to comment
mr.bukol Posted March 2, 2010 Share Posted March 2, 2010 sir yung prescription ko pala , gusto ko sana e order with juliet prescription lenses ? kaya ka yun ? Quote Link to comment
striker1012 Posted March 3, 2010 Share Posted March 3, 2010 sir interested in getting a prescription glasses from you.pm me if the new stocks arrived already.thanks Quote Link to comment
javachip15 Posted March 4, 2010 Share Posted March 4, 2010 i'm in need of an Oakley Square Whisker - Pewter / Black Iridium ASAP Quote Link to comment
Mild Seven Posted March 5, 2010 Share Posted March 5, 2010 kasmutingrato, sent you a pm, hope you can reply, thanks. Quote Link to comment
FirefoxZilla Posted March 6, 2010 Share Posted March 6, 2010 met Gilbert earlier in Trinoma to get the black revere rx for my gf, she can't wait to have them with her prescription. The glasses are perfect and i really don't know why he can price his items that low, truly a great buy for all of his oakley products. Hey Bro Gilbert thanks for meeting me earlier in trinoma and i can't wait for your new stocks to arrive, see you soon, hehehe. Quote Link to comment
kasmutingrato Posted March 6, 2010 Author Share Posted March 6, 2010 GOOD DAY SIR,,,, SORRY PO SA LAHAT IM DEAD BC AT WORK RIGHT NOW KAYA BIHIRA PO AKO MAKA ONLINE... Sir ray004<<<<<my price for wiretap is 7,500 the cobalt wiretap was compromise to sir Koophal closing deal will be next week, ill try to look into my "SAKO" kung meron pa akong wiretap... Sir Mojoko<<<<< i cant promise your lens sir,,, but ill try, no price as of now sir... Sir mmaunltd<<<< i dont have it right now but i can order it sir, kindly IM me the exact model and code, kindly leave also your contact details once the unit arrive... Sir greg8tan<<<<< TXT ME ASAP..... Sir mr.bukol<<<<< Re Juliet Prescription? kaya po sir kindly IM me all of the details of your prescription and ill ask my supplier how much will it cost, kindly include also the color of the lens, is it Iridium, iridium polarized.... pls send it ASAP or txt me the detail ASAP striker1012<<<<< ummmm bro... i cant promise to txt you ASAP once the unit arrived, i will post it then you txt me... this will gunna be really really Fast,,, if you have time just kindly monitor my update and post you will know when it will arrive and anticipate the date and time.... sir javachip15<<<< are you asking me sir if i have this unit? or are you ordering for this model? if you are ordering you know the drill.... Sir Mildseven<<<<< PM replayed sir.... Sir FirefoxZilla<<<<< sir thanks for a very smooth deals sir, hope you could be one of us here im my tread, A COLLECTOR.... TO ALL TENTATIVE ARRIVAL OF YOUR ORDER IS ON APRIL.......but ill call again US tonight to confirm my order.... who's lucky and who's gunna wait for another shipment........ Quote Link to comment
kidneythief Posted March 7, 2010 Share Posted March 7, 2010 Sir mron ka pa ba Pit Boss? Complete w/ box ba? Thanks Quote Link to comment
kasmutingrato Posted March 7, 2010 Author Share Posted March 7, 2010 Sir mron ka pa ba Pit Boss? Complete w/ box ba? Thanks Yes sir my Last Pair of Pit Boss Matt black, no box, no certificate, just the pouch price is 17,500.00 Quote Link to comment
striker1012 Posted March 8, 2010 Share Posted March 8, 2010 @ grato-sir thanks,will monitor for any update.have a great day! Quote Link to comment
FirefoxZilla Posted March 9, 2010 Share Posted March 9, 2010 (edited) http://2.bp.blogspot.com/_0H0gnjnDGWo/R1QGFokV7MI/AAAAAAAAGJM/uy8eod-IOIo/s1600-R/oakley_mcnish2.jpg Bro Kas ask ko lang kung anong model type ng oakley eto? see pic above. i think it's a gascan pero iba kasi ang frame nya, Meron ka bang ganyang model? Sir vinrose67, Sir gilbert... i think this is the oakley canteen, http://www.oakley.com/pd/3681/15304 Edited March 9, 2010 by FirefoxZilla Quote Link to comment
Dwinski Posted March 10, 2010 Share Posted March 10, 2010 price as of now sir... TO ALL TENTATIVE ARRIVAL OF YOUR ORDER IS ON APRIL.......but ill call again US tonight to confirm my order.... who's lucky and who's gunna wait for another shipment........ Ang tttttaaaaaggggggaaaaallllllll naman. But I am willing to wait. Just inform us asap Sir Kas!!!! Thanks! Quote Link to comment
greg8tan Posted March 11, 2010 Share Posted March 11, 2010 Thank you Gilbert for meeting me at the Fort and for a smooth transaction... i like my Rx glassesI must say that its really value for money to deal with you!I'm looking forward to the arrival of your new stocks this April! Quote Link to comment
ygore Posted March 11, 2010 Share Posted March 11, 2010 how much kung lens lang sir? meron kasing grado na ung juliet and gascan ko kaso tumaas na ung grado ng mata ko... possible po ba na lens lang bilhin ko with prescription?? nagtanong tanong kasi ako sa mga optical dito ndi pa daw nila kaya maglagay ng grado sa shades... Thanks in advance for your reply Quote Link to comment
kasmutingrato Posted March 11, 2010 Author Share Posted March 11, 2010 how much kung lens lang sir? meron kasing grado na ung juliet and gascan ko kaso tumaas na ung grado ng mata ko... possible po ba na lens lang bilhin ko with prescription?? nagtanong tanong kasi ako sa mga optical dito ndi pa daw nila kaya maglagay ng grado sa shades... Thanks in advance for your reply i will ask sir pls do send me your rx grade so that i can inquire, kindly include the color of the lens you desire... Quote Link to comment
Recommended Posts
Join the conversation
You can post now and register later. If you have an account, sign in now to post with your account.
Note: Your post will require moderator approval before it will be visible.